|
|
The Organization
|
|
New!
New!
|
|
Research
|
Online databases
Online analysis tools
|
|
Forums
|
News & Commentary
Jobs Forum (Career Center)
Bulletin Board
Bioclusters
Biodevelopers
Molecular visualization
|
|
|
To submit a job announcement, please click here.
To get a summary of past and present positions listed, click here.
To subscribe or unsubsribe, click here.
| Latest announcements |
RESPONSIBILITIES:
Sydney Bioinformatics, a Centre of the University of Sydney, is currently seeking a proactive and results-driven Senior Bioinformatics Project Officer. Based in Camperdown, this position will see you manage complex service-based bioinformatics projects in collaboration with life science researchers, and supervise junior bioinformatics project officers.
REQUIREMENTS:
This role requires exceptional skills in all aspects of microarray experimental design and statistical data analysis, including normalisation, differential expression, clustering, and ontology/pathway analysis. It will also require you to have the ability to prepare and deliver scientific training and education programs in microarray data analysis for life science researchers.
This role is suited to an innovative thinker with a strong customer service ethos and good coaching skills. Due to the nature of this role, it is important that you have great written and verbal communication and presentation skills, and a willingness to learn new skills and embrace novel ideas.
To succeed, you will need relevant postgraduate qualifications and a solid background in bioinformatics and a life science discipline that has given you a familiarity with the application of bioinformatics to life science research. Strong programming and software development skills in PERL, Python, C++, R, or Java will be essential, as will solid general IT skills and experience, and a familiarity with Linux/Unix environments. Comprehensive experience with common online bioinformatics software and databases such as UniProt, GenBank, BLAST, or Bioconductor will also be required.
Highly organised and attentive to detail, you will maintain accurate project management records and documentation and contribute to scientific manuscripts and presentations. You may also be called upon to develop a bioinformatics research program and contribute to bioinformatics teaching activities within the University.
To succeed at the senior level, you will need to meet the above criteria and additionally possess considerable post-qualification work experience in the design and statistical analysis of large, complex microarray data sets. Solid experience in project management, staff management or supervision, and the design and delivery of education and training programs will be highly desirable.
This role offers an outstanding opportunity to work with leading researchers and contribute to cutting-edge research projects in a wide variety of fields. Your involvement in project and team management will help you solidify your career in this emerging discipline.
TERMS:
This position is full-time fixed term until December 2009, subject to the completion of a satisfactory probation period for new appointees. Membership of a University approved superannuation scheme is a condition of employment for new appointees.
SALARY & BENEFITS:
Level of appointment and responsibility will be commensurate with qualifications and experience.
Remuneration package Level 8: up to $85,799 - $96,763 p.a. pro rata (which includes a base salary $72,501 - $81,766 p.a., leave loading and up to 17% employer's contribution to superannuation).
Remuneration package Level 9: up to $99,502 - $104,990 p.a. pro rata (which includes a base salary $84,080 - $88,718 p.a., leave loading and up to 17% employer's contribution to superannuation).
HOW TO APPLY:
For more information and to apply, please visit http://positions.usyd.edu.au/bpo
Specific enquiries about the role can be directed to Jonathan Arthur on (+61 2) 9036 3132. General enquiries can be directed to Ivana Crossley on (+61 2) 9036 7298 or i.crossley@usyd.edu.au
REFERENCE NUMBER: 135567
DEADLINE: 19 August 2008
|
RESPONSIBILITIES:
The Compound Management Process Scientist will be responsible for the execution of the day to day procedures necessary to accomplish the business critical function of Compound Management. Responsibilities include the execution of work orders, tracking of metrics, Quality Control of instrumentation and communication with scientific community. Individuals who seek challenges in improving workflows and integrating automation equipment are preferred.
REQUIREMENTS:
B.S., or M.S. in Chemistry or Biology with 2 to 7 years experience in Compound Management preferred. Demonstrated record of competency in chemistry, high throughput screening, or compound management. Ability to follow complex workflows and procedures utilizing automated systems and liquid handling equipment. Demonstrated problem solving ability. Strong oral and written communication skills. Basic understanding of medicinal, synthetic and or combinatorial chemistry. Familiarity with chemical, biological information systems, especially database searching is preferred.
HOW TO APPLY:
To formally apply for this position, please go online to http://www.bms.com/career/data/. You may search for the position above by requisition number from the detailed search page. Please apply to requisition #25926.
|
OVERVIEW:
The Buck Institute seeks to recruit a Faculty member working in the area of Computational Biology and/or Bioinformatics. Outstanding junior or senior scientists are encouraged to apply. The appointment can be made at the Assistant/Associate or Full Professor level. Candidates with an interest in developing computational tools and applications for complex biological data analysis in systems biology, or cellular processes are particularly encouraged to apply. The successful candidate will play a leadership role in developing collaborative interdisciplinary programs with other Institute Faculty in areas including, but not limited to, the biology of aging, stem cell biology, and cancer and neurodegenerative disease.
LOCALE:
The Buck Institute is an independent research institute located 20 miles north of San Francisco whose research mission is to understand the mechanisms of aging and age-related disease. The Institute fosters an interdisciplinary and highly collaborative research environment, with expertise in chemistry, biology, proteomics, stem cells and model system genetics.
HOW TO APPLY:
To apply, please send (1) current curriculum vitae, (2) statement of research interests, (3) and the names of at least three references to:
Buck Institute for Age Research
Computational Biology Search Committee/HR
8001 Redwood Blvd.
Novato, CA 94945
Electronic applications can be sent to: hr@buckinstitute.org
|
My main research interests are modelling in physiology and molecular biology. The doctoral thesis is named “The influence of low power laser radiation on the cold-blooded and warm-blooded cardiac activity” was dedicated to investigation of influenece of He-Ne laser upon a properties of heart rhythm.
FOR MORE INFORMATION:
http://www.scivis.ifc.cnr.it/yuri.htm
|
BACKGROUND:
Scisco Genetics Inc., a recent spin-off from the Fred Hutchinson Cancer Research Center, is seeking a senior software developer. The successful candidate will be part of a small team of developers and biologists and will be able to contribute to the design, implementation, and testing of a scientific data management and analysis application used for collecting, analyzing, reporting, and sharing genetic and genomic data.
The near term goals of the company are to establish software solutions for sale and support to the biomedical scientific community, especially as they relate to the acquisition and analysis of genetic data for application to clinical medicine. The Company will support the further technical development and deployment of software, called the Genetics Management System (GeMS), now in use in a number of independent research laboratories. This system includes tools for data acquisition, archiving, querying, retrieval, visualization, integration and management, web-based linkage tools for data sharing and tools for electronic communication, and new analytical tools for interpretation of complex DNA sequence data. Specific plans include improving existing tools and implementing new solutions for data analysis, extending GeMS to support new data models, improving the functionality towards interaction with other systems, and expanding the number of deployments. These efforts will engage the development and application of new biocomputing tools or technologies for particular areas of scientific opportunity in biomedical research.
TERMS:
Support for this opportunity is currently available for 3 years through funding from the National Institutes of Health. Long-term goals include establishing a successful company within the framework of opportunities now emerging for informatics solutions in support of biomedical applications, with specific emphasis on medical genetics.
REQUIREMENTS:
- Basic knowledge of Linux systems administration.
- At least 4-5 years experience developing Java/JEE applications.
- Understand Agile software development and apply it throughout the development life cycle. Able to design UML and ERD diagrams.
- Able to work independently, but also happy to work with and support fellow team members.
- Creative and interested in science. Desire to learn conceptually about state of the art applications of genetics and genomics in medicine.
Required Skills:
- Languages: Java, XML, HTML
- Operating System: Linux
- Technologies: JEE, Struts
- Database: SQL, JDBC
- Tools: A Java IDE, source control concepts, unit testing tools, a UML tool
Bonus Skills:
- Languages: JavaScript, CSS
- Technologies: JBoss, Tomcat
- Database: PostgreSQL
- Tools: Eclipse, Subversion, Ant, Selenium
- Scientific background
RESPONSIBILITIES:
- Responsible for all aspects of the software development life cycle, from collecting software requirements to supporting a solution in production.
- Apply Agile software development skills to create software that works in a dynamic environment with changing requirements.
- Design, refactor, implement, test, and support software for a J2EE environment.
- Write maintainable, scalable, extensible software using open source tools.
- Participate in design and code reviews.
BUSINESS TITLE: Systems Analyst/Programmer IV
JOB TYPE: Full time position
LOCALE: Seattle, WA
JOB CATEGORY: Computers
SALARY & BENEFITS: Salary DOE+ excellent benefits
OPENING DATE: Today
CLOSING DATE: Until Filled
HOW TO APPLY:
Please email, fax or mail your contact information. The address for this position is: Human Resources, Scisco Genetics Inc., 7 Harrison Dr., #701, Seattle, WA 98109. Office hours: Monday - Saturday, 8:30 - 7:00.
Email: info@SciscoGenetics.com
Fax: (206) 260-8876
Phone Number: (206) 890-2304
Web Site: http://www.SciscoGenetics.com (under construction)
Scisco Genetics Inc. is an equal opportunity employer, committed to workforce diversity.
|
BACKGROUND:
PhD position in systems biology, mathematical modeling of cellular signaling pathways. Structured PhD Programme in Bioinformatics and Computational Medicine University College Dublin, Ireland.
Applications are invited for a PhD studentship, starting in October 2008 or later within the Bioinformatics and Computational Medicine Structured PhD Programme (http://bioinformatics.ucd.ie/PhD) at University College Dublin, to work on a research project on spatial and temporal dynamics of cell signaling pathways.
RESPONSIBILITIES:
The successful candidate will undertake a four-year research project on spatial and temporal dynamics of cell signaling under the supervision of B.N. Kholodenko, Z. Neufeld and E.A. Cox.
The project is aimed at understanding how biochemical signaling networks can transmit precise spatial information in a dynamic and robust manner to control the execution of spatially resolved cellular processes. The models developed will be based on nonlinear reaction-diffusion equations representing GTPase and kinase/phosphatase signaling cascades which control pivotal cellular processes. Computational models will involve primarily ordinary and partial differential equations, although stochastic methods and probabilistic approaches may also be used. Applicants should have a genuine interest in modeling of biological processes and experience with nonlinear dynamics and numerical calculations. Although the work will mostly involve theoretical/computational modeling, there will be some participation in experimental work. (see [link] for further details of the project)
REQUIREMENTS:
Applicants should hold or expect to obtain a degree in a numerate discipline, particularly with experience of mathematical and computational modeling (e.g. mathematics, computational science, computational biology, physics, chemical or bio-engineering or related areas).
HOW TO APPLY:
For further enquiries please contact: B.N. Kholodenko (Boris.Kholodenko@jefferson.edu) or Z. Neufeld (zoltan.neufeld@ucd.ie).
Applicants should send a CV and names and addresses of two referees to bioinfo@ucd.ie before the closing date of 8 August 2008.
|
Yale University offers exciting opportunities for achievement and growth in New Haven, Connecticut. Conveniently located between Boston and New York, New Haven is the creative capital of Connecticut with cultural resources that include three major museums, a critically-acclaimed repertory theater, state-of-the-art concert hall, and world-renowned schools of Architecture, Art, Drama, and Music.
RESPONSIBILITIES:
Working with a dynamic and growing team in the Informatics Group of the Yale Center for High Throughput Cell Biology, independently deploy and support small molecule and RNAi high throughput screening informatics systems.
The Informatics team is seeking bioinformaticians with a breadth of knowledge in the areas of genomic screening data analysis, phylogenetic clustering, and gene ontology and cellular pathways mapping. The Yale Center for High Throughput Cell Biology will be a unique and exiting environment employing technologies on the cutting edge of high throughput cell biology.
Position Description:
- Deploy tools that combine small molecule, genomics, proteomics and literature data to interpret complex phenotypic cell-based assays. Develop, deploy, use and support data analysis, biostatistics and visualization solutions to explore gene clustering, pathways analysis and higher level gene ontology and cellular pathway relationships.
- Analyze experimental protocols; anticipate informatics solutions required to accomplish research objectives. Develop, integrate and support new solutions to achieve project goals. Perform complex bioinformatics analyses on experimental results. Report findings and recommend steps for furthering research objectives.
- Define and assess various bioinformatics analysis, visualization and reporting needs on an ongoing basis to inform project development. Research alternatives, present findings to team and lead the implementation of solutions that will achieve strategic technical objectives.
- Plan for and implement solutions to support new research areas and future growth. Independently assess and design preemptive solutions against potential informatics systems problems. Design and implement an informatics disaster recovery plan.
- Deploy and support informatics solutions across Center. Train scientists at all levels to utilize the tools deployed by the Informatics Department.
- Understand, anticipate and execute goal-directed activities toward achieving clients needs and Center goals. Seek out and form collaborations to leverage resources in favor of project and Center objectives. Prepare materials for presentation and reporting to stakeholders and others as needed.
REQUIREMENTS:
- Masters Degree in a specific scientific discipline and three years of experience, or an equivalent combination of education and experience.
- Bachelors, Masters, or Ph.D. degree (or equivalent degree) in Bioinformatics, Computer Science, Biology, or relevant discipline.
- Experience with relevant analysis software.
- Experience with at least one programming language.
- Preferred: Experience characterizing gene functions and gene/protein pathways; Bioinformatics experience in the pharmaceutical or biotech industry, specifically in the area of genomic screening data analysis; Pipeline Pilot, Spotfire, Bioconductor,R. software experience; experience with PL/SQL.
HOW TO APPLY:
For more information and immediate consideration, please apply online at http://www.Yale.edu/jobs - the STARS req ID for this position is 5014BR. Please be sure to reference source code IBIOI when applying for this position.
We invite you to discover the excitement, diversity, rewards and excellence of a career at Yale University. One of the country's great workplaces, Yale University offers exciting opportunities for meaningful accomplishment and true growth. Our benefits package is among the best anywhere, with a wide variety of insurance choices, liberal paid time off, fantastic family and educational benefits, a variety of retirement benefits, extensive recreational facilities, and much more.
Yale University is an affirmative action/equal opportunity employer. Yale values diversity in its faculty, staff, and students and strongly encourages applications from women and members of underrepresented minority groups.
|
Yale University offers exciting opportunities for achievement and growth in New Haven, Connecticut. Conveniently located between Boston and New York, New Haven is the creative capital of Connecticut with cultural resources that include three major museums, a critically-acclaimed repertory theater, state-of-the-art concert hall, and world-renowned schools of Architecture, Art, Drama, and Music.
RESPONSIBILITIES:
Collaborate with the Director of the Center in setting priorities for project development and expansion. Research and develop ideas for improvement of existing HTS equipment. Play a significant role in the development and ongoing implementation of scientific and operational plans for the HTS section. Participate in the design of projects. Establish reports relating to the work performed for each project involving the HTS suite and submitting them in a timely fashion. Responsible for maintaining and updating comprehensive SOPs relating to the different procedures and protocols uses, implemented and/or developed in the HTS section. Have limited management of staff.
The Yale Center for HTS Biology performs automated high-throughput screening (HTS) on biological assays.
Position Description:
- Continually maintain several robust and flexible automated high-throughput screening platforms.
- Provide information and practical assistance to our informatics partners on a need-to basis as required to establish an integrated LIMS.
- Work with biologists and informatics in the Center to generate high quality products.
- Perform chemical screens in conjunction with lead scientists in an efficient, validated, modular manner.
- Perform siRNA screens in conjunction with lead scientists in an efficient, validated, modular manner.
- Perform Lentivirus production development in conjunction with lead scientists in an efficient, validated, modular manner.
- Perform Adenovirus production development in conjunction with lead scientists in an efficient, validate, modular manner
- Generate daughter libraries of master compounds, Lenti and Adeno virus libraries in accordance with safety handling procedures and scientific protocols.
- Maintain an inventory of resources related to the HTS section and continually re-stock consumables in a timely and cost efficient manner.
- Conduct research of similar fields and recommend best practice for work relating to HTS.
- Forecast time frames for projects, upgrades, maintenance and other HTS related activities.
- Verify and maintain accuracy of data, records of use of reagents such as compound libraries and siRNA libraries; submit reports to the Director in a timely fashion.
- Document each project in a modular fashion including modular SOPs
REQUIREMENTS:
- Master's Degree in Chemistry, Biology, Biochemistry or other related discipline and one year of experience; or an equivalent combination of experience and education.
- Experience with high-throughput screening on biological assays.
HOW TO APPLY:
For more information and immediate consideration, please apply online at http://www.Yale.edu/jobs - the STARS req ID for this position is 5012BR. Please be sure to reference source code IBIOI when applying for this position.
We invite you to discover the excitement, diversity, rewards and excellence of a career at Yale University. One of the country's great workplaces, Yale University offers exciting opportunities for meaningful accomplishment and true growth. Our benefits package is among the best anywhere, with a wide variety of insurance choices, liberal paid time off, fantastic family and educational benefits, a variety of retirement benefits, extensive recreational facilities, and much more.
Yale University is an affirmative action/equal opportunity employer. Yale values diversity in its faculty, staff, and students and strongly encourages applications from women and members of underrepresented minority groups.
|
Yale University offers exciting opportunities for achievement and growth in New Haven, Connecticut. Conveniently located between Boston and New York, New Haven is the creative capital of Connecticut with cultural resources that include three major museums, a critically-acclaimed repertory theater, state-of-the-art concert hall, and world-renowned schools of Architecture, Art, Drama, and Music.
RESPONSIBILITIES:
Provide management and high level technical automation skills to the new Yale Center for High Throughput Biology. Formulate and execute research plans relating to the set up and improvement of the HTS suite and related areas. Propose budgets; manage staff. Design, build and continually maintain several robust and flexible automated high-throughput screening platforms. Research and stay current with new technological advances in the field and recommend new technology and processes to the Director.
Position Description:
- Maintain an inventory of resources related to the HTS section and continually re-stock on consumables in a timely and cost efficient manner. Provide the information and practical assistance to informatics partners needed to establish an integrated LIMS (lab information management system).
- Negotiate contracts for maintenance and support against a pre-set budget.
- Conduct research of similar fields and recommend best practice for work relating to HTS. Keep up-to-date on advances in technology and make recommendations for new processes and technology.
- Perform chemical screens in conjunction with lead scientists in an efficient, validated, modular manner, on time and within budget.
- Perform siRNA screens in conjunction with lead scientists in an efficient, validated, modular manner, on time and within budget.
- Perform Lentivirus production development in conjunction with lead scientists in an efficient, validated, modular manner, on time and within budget.
- Perform Adenovirus production development in conjunction with lead scientists in an efficient, validated, modular manner, on time and within budget.
- Forecast time frames for projects, upgrades, maintenance and other HTS related activities.
- Generate daughter libraries of master compounds, Lenti and Adeno virus libraries in accordance with safety handling procedures and scientific protocols.
- Document each process and project in a modular fashion including modular SOPs. Provide technical assistance on high throughput automation and equipment maintenance, as requested.
- Present data at meetings and presentations in written and oral formats.
- Verify and maintain accuracy of data and records about use of reagents such as compound libraries and siRNA libraries; submit reports to the Director in a timely fashion.
- Use funds available from cost-savings generated within the HTS section to improve process and technology. Propose budget for projects and ongoing maintenance to Director.
- Plan and execute an annual budget for HTS in conjunction with the Director and business manager.
- Manage present and future staff; make recommendations about staffing.
REQUIREMENTS:
- Master's Degree in Chemistry, Biology, Biochemistry or other related discipline and three years of experience; or an equivalent combination-of experience and education.
- Masters or Bachelors Degree in automation, robotics, computers or related or equivalent work experience.
- Preferred: Project and staff management experience.
HOW TO APPLY:
For more information and immediate consideration, please apply online at http://www.Yale.edu/jobs - the STARS req ID for this position is 5011BR. Please be sure to reference source code XXXXX when applying for this position.
We invite you to discover the excitement, diversity, rewards and excellence of a career at Yale University. One of the country's great workplaces, Yale University offers exciting opportunities for meaningful accomplishment and true growth. Our benefits package is among the best anywhere, with a wide variety of insurance choices, liberal paid time off, fantastic family and educational benefits, a variety of retirement benefits, extensive recreational facilities, and much more.
Yale University is an affirmative action/equal opportunity employer. Yale values diversity in its faculty, staff, and students and strongly encourages applications from women and members of underrepresented minority groups.
|
BACKGROUND:
We are currently searching for a Bioinformatics Software Developer to support the National Institutes of Health (NIH). This opportunity is a permanent, full-time position with Lockheed Martin and it is on-site at the NIH in Bethesda/Rockville, MD.
The candidate will operate in a multi-disciplinary group of scientists, software developers, and operations staff who provide support, training, consultation services and informatics tools to the research community in the areas of bioinformatics and computational biosciences. The successful candidate will be energetic, flexible, personable and highly creative. Candidates *MUST* have excellent communication and documentation skills.
MAJOR DUTIES AND RESPONSIBILITIES:
- Design, implement, test, deploy, and maintain bioinformatics applications (web-based or standalone) to meet the needs of the research community;
- Translate user requests into scripts to streamline research processes;
REQUIREMENTS:
Education and skills:
- Ph.D. (preferred) or M.S. (with equivalent work experience) in Bioinformatics, Computational Biology, Computer Science, or related computational discipline ;
- Initiative in experimenting with new technologies;
- Demonstrated ability to apply project management techniques to track, update, and generate reports for ongoing projects and support actions;
- Ability to work independently, be detail-oriented and have excellent analytical skills;
- Outstanding communication and interpersonal skills.
Documented expertise in the following areas required
- Object-oriented programming: Java, C# or Object-Oriented Perl;
- Relational database development and SQL query: SQL server or MySQL;
- Sequence analysis, alignment and database searches;
- Web development and Web Service implementation;
- Excellent user-interface design skills.
Experience with or extensive knowledge of the following a plus:
- High performance computing clusters;
- Mathematical analysis, modeling, and programming;
- Microsoft .Net Framework development
HOW TO APPLY:
Please send resumes to David Dowling, Sr, Recruiter Lockheed Martin. David.A.Dowling@lmco.com
|
|
Via BioinformaticsZen.com:
``When I wrote a post about my opinion of doing a career in bioinformatics I got the impression from the comments that this was something many people wanted more information about. Pedro and I had some discussion, and thought it might be interesting to create an online survey, to get current researchers? opinions of working in the field of bioinformatics. So, the below survey begins today (July 1) and is filled out by as many people as possible over the course the next month. The data is then released into the public domain at the start of next month (August 1). Anyone who is then interested can contribute back analysis of this data, so that on September 1 hopefully we can compile together lots of interesting statistics and graphs into a handy document discussing the highs and lows of career in bioinformatics.''
The survey can be found at the Bioinformatics.Org Career Center through July:
http://www.bioinformatics.org/jobs/
Full story:
[link]
|
BACKGROUND:
The Rockefeller University, a premier biomedical research institute located on Manhattan's Upper East Side seeks a Scientific Programmer to work in our Hospital Biostatistics Department. The successful candidate will perform programming, analysis, design, and support for phenotyping recording and analysis software toolset.
REQUIREMENTS:
Master's degree required; educational emphasis in bioinformatics preferred. Must have a strong understanding of basic biology, genomics, and ontology development, previous experience with bioinformatics, programming, and database work, and have strong computational skills, including data parsing, data analysis, and database implementation. Experience with PERL, R, SQL, and Python a plus. Must be able to review and synthesize scientific data, and communicate well in person and in writing.
SALARY & BENEFITS:
We offer an excellent benefits package, tuition reimbursement and a competitive salary. The Rockefeller University is located on Manhattan's Upper East Side, on a 15-acre campus, along the East River ( http://www.rockefeller.edu/views.php ).
HOW TO APPLY:
To apply for this position please visit us at http://www.rockefeller.edu/hr/jobs.php, keyword Scientific Programmer, or IRC 4941.
The Rockefeller University is an Affirmative Action/VEVRAA/Equal Opportunity Employer.
|
LOCALE:
Department of Neurological Surgery, the Robert H. Lurie Comprehensive Cancer Center, Lurie Center for Cancer Genetics Research, and the Center for Genetic Medicine of Northwestern University Feinberg School of Medicine
BACKGROUND:
The Northwestern Brain Tumor Institute Basic and Translational Science Program is a leader in applying functional and computational genomics tools and network analysis to the pathobiology of human gliomas. The Northwestern Feinberg School of Medicine, the Robert H. Lurie Comprehensive Cancer Center, the Lurie Center for Cancer Genetics Research, and the Center for Genetic Medicine have committed significant, new laboratory space for a dynamic, integrative program focusing on translational and basic brain tumor research. In addition to an exciting work environment, we also offer a competitive salary and benefits package.
RESPONSIBILITIES:
The Northwestern Brain Tumor Institute Molecular Profiling and Research Program is recruiting an exceptional and highly motivated Postdoctoral Scientist to expand efforts in computational/functional genetics/genomics-based research, both basic and translational, addressing the molecular mechanisms of glioma evolution and resistance to therapy.
REQUIREMENTS:
We are interested in candidates with extensive experience in computational genomics/biostatistics, particularly the analysis of high-throughput genome-wide datasets (expression, gene copy number, SNP, loss of heterozygosity, methylation, microRNA) and the use of public genomic databases, such as TCGA, Cancer Genome Project, GDB, SMD, GEO, Array Express, and Celsius.
Positions are intended for outstanding candidates with proven research credentials. Postdoctoral candidates are expected to hold a doctoral (Ph.D.) degree in biostatistics. Candidates should have a strong desire to work in a multidisciplinary environment. We discourage applicants to apply who do not meet those qualifications.
HOW TO APPLY:
Interested Postdoctoral Scientist candidates should submit via e-mail an electronic copy of their curriculum vitae, a cover letter describing their past research experience, career goals and a statement of research interests, along with complete contact information for at least three references to:
Markus Bredel, M.D., Ph.D.
Director, Northwestern Brain Tumor Institute Research Program
j-renfrow@northwestern.edu
Northwestern University is an Affirmative Action/Equal Opportunity Employer. Hiring is contingent upon eligibility to work in the United States. Women and minorities are encouraged to apply.
|
Postdoctoral positions are available immediately at the Center for Bioinformatics, Department of Molecular Bioscience, University of Kansas.
RESPONSIBILITIES:
Projects will involve protein structure prediction (algorithm development), GPCR and membrane protein structure modeling, high resolution protein structure refinement, and protein docking.
REQUIREMENTS:
Candidates with experience in following fields are encouraged to apply:
- Protein structure prediction (including threading, ab initio modeling and high-resolution structure refinement)
- Protein sequence and structure alignments
- Protein-protein & protein-ligand docking
- New drug design
Strong candidates with interest in other bioinformatics related topics will be considered as well.
HOW TO APPLY:
To apply, please send your CV and a brief description to Yang Zhang (Email: yzhang@ku.edu)
|
BACKGROUND:
Agilent Technologies is the world's premier measurement company. Agilent provides core electronic and bio-analytical measurement tools to advance the electronics, communications, life science research, environmental and petrochemical industries. We're creating the tools and technologies that are changing the way we understand our world.
If you're creative, adaptive, willing to learn and have more fun than ever before - join Agilent today. Visit http://www.agilent.com/go/jobs. Our people make the difference.
Agilent's pioneering spirit was kindled more than 60 years ago, when two engineers - Bill Hewlett and Dave Packard - invented the future in their garage. In 1999, Agilent was spun off from Hewlett-Packard Company, and we have continued to support the values so important to the two visionary founders. While, physically, we have outgrown HP's garage, we continue to live the values handed down from Bill and Dave: uncompromising integrity: trust, respect and teamwork: and innovation that makes a difference.
RESPONSIBILITIES:
Responsible for on-site installation, implementation, maintenance and repair of company and multi-vendor systems solutions which may include hardware, software and networking products as well as operating systems. Installs and optimizes hardware/software/network products and configurations at customer sites. Diagnoses and resolves product performance problems. Performs maintenance and repair services. Ensures customer satisfaction by advising customers on preventive maintenance and configurations, which may impact product performance. Proactively responds to potential equipment issues to prevent unplanned interruption of customers' business. Delivers (does not design) fully integrated solutions, which may include peripherals, communications, operating systems and applications software. Serves as an internal resource on technical issues. May train other field engineers or customers. May calibrate equipment on-site for large volume customers.
- Determines and develops approaches to assignments
- Leads field services and support projects requiring coordination with other functions, customers
- Solves a broad range of hardware and/ or software problems of varying scope and complexity
REQUIREMENTS:
- Bachelors or Master Degree or University Degree or equivalent
- Minimum of 4 years relevant experience, with typically 5 to 8 years
LOCALE: Bangalore, Karnataka India
SALARY AND BENEFITS: Competitive
HOW TO APPLY:
We would like to have our candidates directed to this URL:
[link]
|
BACKGROUND:
Scisco Genetics Inc., a recent spin-off from the Fred Hutchinson Cancer Research Center, is seeking a senior software developer. The successful candidate will be part of a small team of developers and biologists and will be able to contribute to the design, implementation, and testing of a scientific data management and analysis application used for collecting, analyzing, reporting, and sharing genetic and genomic data.
The near term goals of the company are to establish software solutions for sale and support to the biomedical scientific community, especially as they relate to the acquisition and analysis of genetic data for application to clinical medicine. The Company will support the further technical development and deployment of software, called the Genetics Management System (GeMS), now in use in a number of independent research laboratories. This system includes tools for data acquisition, archiving, querying, retrieval, visualization, integration and management, web-based linkage tools for data sharing and tools for electronic communication, and new analytical tools for interpretation of complex DNA sequence data. Specific plans include improving existing tools and implementing new solutions for data analysis, extending GeMS to support new data models, improving the functionality towards interaction with other systems, and expanding the number of deployments. These efforts will engage the development and application of new biocomputing tools or technologies for particular areas of scientific opportunity in biomedical research.
Support for this opportunity is currently available for 3 years through funding from the National Institutes of Health. Long-term goals include establishing a successful company within the framework of opportunities now emerging for informatics solutions in support of biomedical applications, with specific emphasis on medical genetics.
REQUIREMENTS:
- Basic knowledge of Linux systems administration.
- At least 4-5 years experience developing Java/JEE applications.
- Understand Agile software development and apply it throughout the development life cycle. Able to design UML and ERD diagrams.
- Able to work independently, but also happy to work with and support fellow team members.
- Creative and interested in science. Desire to learn conceptually about state of the art applications of genetics and genomics in medicine.
Required skills:
- Languages: Java, XML, HTML
- Operating System: Linux
- Technologies: JEE, Struts
- Database: SQL, JDBC
- Tools: A Java IDE, source control concepts, unit testing tools, a UML tool
Bonus skills:
- Languages: JavaScript, CSS
- Technologies: JBoss, Tomcat
- Database: PostgreSQL
- Tools: Eclipse, Subversion, Ant, Selenium
- Scientific background
RESPONSIBILITIES:
- Responsible for all aspects of the software development life cycle, from collecting software requirements to supporting a solution in production.
- Apply Agile software development skills to create software that works in a dynamic environment with changing requirements.
- Design, refactor, implement, test, and support software for a J2EE environment.
- Write maintainable, scalable, extensible software using open source tools.
- Participate in design and code reviews.
TITLE: Systems Analyst/Programmer IV
TERMS: Full time position
LOCALE: Seattle, WA
CATEGORY: Computers
SALARY & BENEFITS: Salary DOE+ excellent benefits
HOW TO APPLY:
Please email, fax or mail your contact information. The address for this position is: Human Resources, Scisco Genetics Inc., 7 Harrison Dr., #701, Seattle, WA 98109. Office hours: Monday - Saturday, 8:30 - 7:00.
Email: info@SciscoGenetics.com
Web Site: http://www.SciscoGenetics.com (under construction)
Scisco Genetics Inc. is an equal opportunity employer, committed to workforce diversity.
OPENING DATE: Today
CLOSING DATE: Until Filled
|
RESPONSIBILITIES:
Dartmouth Medical School and the Norris Cotton Cancer Center seek applicants for a computer programmer. The successful candidate will develop and implement programmatic workflows for a modern mass spectrometry-based proteomics research laboratory, including web interfaces for parallel computer-based spectral matching programs, web-based data browsing and results reporting tools, LC-MS data analysis and visualization tools, and integration of information display with database-based results management.
Proteomics research at the Norris Cotton Cancer Center includes developing and implementing novel mass spectrometry-based methods to improve our understanding of lung cancer, as well as to discover early signaling events in tumorigenesis that may serve as early diagnostic indicators of disease. Programming support for these topics is a critical component of successfully achieving our research goals.
Key accountabilities:
- Develops new tools for proteomics workflows
- Writes or adapts programs for laboratory use
- Works in a team environment with faculty, staff, students and postdoctoral fellows, as well as system administrators, statisticians, and others associated with proteomics workflows
- Participates in experimentation, data analysis and interpretation of proteomics datasets
- Participates in a dynamic team environment of group education, assists with manuscripts, and general contributions to further knowledge within the group and Medical School
REQUIREMENTS:
- Operational expertise in Linux/UNIX/Windows environments
- Skilled in PHP/cgi, Perl, and other languages involved in web interface creation
- Familiarity with C/C++ is desirable
- Ability to work independently and apply critical thinking skills and novel programming solutions to problems
- Excellent interpersonal skills and willingness to work as a team member
- 1 2 years of programming experience
- Bachelors degree (or equivalent) in Computer Science or related discipline
- Continuation of employment based on availability of grant funds
HOW TO APPLY:
Please send a copy of CV, and at least 2 letters of recommendation to scott.a.gerber@dartmouth.edu
Scott A. Gerber, PhD
Tel. (603) 653 3679
|
Apply your computing skills to DNA at MIT!
Have stellar computational skills, PhD or equivalent experience? Enjoy solving nearly impossible problems? We'll retrain you to work with cutting-edge DNA technology!
We find biomedical applications for new DNA sequencing instruments yielding billions of short DNA sequences like
AATGTAATTTCAAATGTTAGCTCATTTTTGTTAATG
We need you on our team to solve the hard mathematical and computational challenges using terabytes of these data. We invent algorithms, delve deeply in the data, code like crazy, help design laboratory experiments: we do whatever is needed to make the new technologies fulfill their promise to unlock the mysteries of genomics and biomedical research in critical areas like cancer, human genetics, infectious disease, antibiotic discovery, genome evolution, man's inhumanity to man, and the number 42.
We seek candidates from highly diverse backgrounds, industrial and academic. Mathematical and computational experience and excellence required, including superb C++ skills in a Linux or Unix environment. Biology training helpful but not required as you can learn on the job. Outstanding oral and written communication skills, joy in teamwork. A group leader position is also open for a candidate with proven leadership experience in computational science.
The Broad Institute of MIT and Harvard has an intense, exciting environment, world-class laboratory and computing facilities, hundreds of scientists tackling a wide range of critical problems in biology and medicine. Come join us!
HOW TO APPLY:
Applications should also be submitted through http://hrweb.mit.edu/staffing/.
Search for mit-00004694, mit-00004693, mit-00003916, and mit-00004577, Software Engineer, Computer Scientist, Computational Biologist, and Group Leader positions. We are an equal opportunity, affirmative action employer.
MIT is an equal opportunity/affirmative action employer. Applications from women, minorities, veterans, older workers, and individuals with disabilities are strongly encouraged.
The Broad Institute was founded to empower scientists of all kinds to work together on difficult, diverse, critical genomic and biomedical challenges. The Institute is a unique collaboration between the MIT and Harvard academic and medical communities, and it offers the security and benefits provided to all MIT employees, including:
- Competitive pay
- Medical, dental, life insurance plans
- 401(k) plan with matching contributions
- Tuition assistance plan
- Four weeks of vacation after one year
- T-Pass subsidy program
- Athletic and fitness centers
- Child care services
Join a team that works the way you've always wanted to work.
|
DESCRIPTION:
Infrafrontier is a new project that aims to establish an efficient, distributed infrastructure for the phenotyping, archiving and dissemination of mouse models on a pan-European level. Key to this is the identification of the bioinformatic requirements to support this infrastructure and the integration of key databases.
We are seeking a Scientific Programmer to lead the bioinformatics element of this project. The person will be based in the Bioinformatics Group and will interact with related groups across Europe. The Bioinformatics group has extensive experience in European databases which hold information about mouse models. It is a key player in the EUMODIC project and is developing the EuroPhenome database to hold large-scale mouse phenotyping data.
The successful candidate will have a strong background in software development or bioinformatics. Previous experience of web technologies, SQL, database integration and data management would be desirable. They will be based in the Bioinformatics Group and will interact with related groups across Europe.
SALARY AND BENEFITS:
Salary from £25,368 - £30,427 per annum depending on experience
Benefits for both positions include 30 days annual leave, competitive salary, and a final salary pension scheme. Please note that final appointment will be subject to pre-employment screening.
DURATION:
Fixed Term until 28 February 2011
HOW TO APPLY:
Ref: MGU08/366
Applications for these roles must be made online at http://jobs.mrc.ac.uk. If you do not have internet access or experience technical difficulties, please call 01793 301156, quoting the relevant reference number.
Closing date for applications: 25 July 2008
The MRC is an Equal Opportunities Employer
�Leading science for better health�
|
A new database at MRC Harwell called Mousebook (http://www.mousebook.org) allows scientists to source information on mouse models at Harwell. This single interface facilitates querying of the MRC Frozen Embryo and Sperm Archive (FESA), ENU DNA archive, mutants from the ENU mutagenesis programme, EMPReSS (phenotyping protocols) and EuroPhenome, a database of mouse phenotype data.
The FESA archive currently holds >1400 mouse stocks and is internationally recognised as one of the largest sources of mouse models of human disease in the world. The embryo bank's stock list is constantly growing in concert with the expansion in the multinational mouse genetics programmes. The Data Manager's role is regarded as critical to the the future exploitation of this valuable genetic resource.
DESCRIPTION:
The Data Manager's role will involve reviewing and updating the MRC's embryo bank stock descriptions and strain nomenclature in keeping with recognised international standards to ensure that the details displayed to the scientific community through Mousebook are up to date, comprehensive and correct. This will involve comparing data from internal sources and a number of external sources including the Mouse Genome Informatics Resource (MGI), Ensembl, Vega and PubMed.
SALARY AND BENEFITS:
Salary from £25,368 - £30,427 per annum depending on experience
Benefits for both positions include 30 days annual leave, competitive salary, and a final salary pension scheme. Please note that final appointment will be subject to pre-employment screening.
DURATION:
Fixed term for 12 months
HOW TO APPLY:
Ref: MGU08/364
Applications for these roles must be made online at http://jobs.mrc.ac.uk. If you do not have internet access or experience technical difficulties, please call 01793 301156, quoting the relevant reference number.
Closing date for applications: 25 July 2008
The MRC is an Equal Opportunities Employer
Leading science for better health
|
|
|
|
|
| Bioinformatics Career Survey |
|
Via Bioinformatics Zen:
"When I wrote a post about my opinion of doing a career in bioinformatics I got the impression from the comments that this was something many people wanted more information about. Pedro and I had some discussion, and thought it might be interesting to create an online survey, to get current researchers? opinions of working in the field of bioinformatics. So, the below survey begins today (July 1) and is filled out by as many people as possible over the course the next month. The data is then released into the public domain at the start of next month (August 1). Anyone who is then interested can contribute back analysis of this data, so that on September 1 hopefully we can compile together lots of interesting statistics and graphs into a handy document discussing the highs and lows of career in bioinformatics."
|
|
|
|
|
|