[BiO BB] clustalw alignment pairwise

Cook, Malcolm MEC at Stowers-Institute.org
Fri Jul 28 12:41:21 EDT 2006


Daniele,

Depending on how often you do this, and your computational and financial
resources, and what platforms you are comfortable with, you might
reconsider your approach.

I particular, I recommend that you consider to use Staden for your
project (http://staden.sourceforge.net/).  It uses Gap4 or phrap under
the hood for assembly purposes, provides a few deffernt methods for
automatically scoring mutations
(http://staden.sourceforge.net/mutations/index.html), provides a gui to
view and curate the (sometimes incorrect) scoring in the context of the
actual traces, and provides a standard output format for reporting the
mutations that takes the ORF of a reference sequence into account for
reporting the consequence of the mutation in both html
(http://staden.sourceforge.net/mutations/index_short.html) and text
format, like this:

001321_11aF 33885T>Y (silent F) (strand - only)
001321_11aF 34407G>K (expressed E>[ED]) (strand - only)
001321_11cF 35512T>Y (silent L) (double stranded)
001321_11cF 35813C>Y (expressed P>[PL]) (double stranded)
001321_11dF 36314A>R (expressed E>[EG]) (double stranded)
001321_11eF 36749A>R (expressed K>[KR]) (double stranded)
001321_11eF 37313T>K (noncoding) (strand - only)
000256_11eF 36749A>G (expressed K>R) (double stranded)

(above from http://staden.sourceforge.net/mutations/index.html)

I've used it to good effect for all the above.

Regards,

Malcolm Cook
Database Applications Manager, Bioinformatics
Stowers Institute for Medical Research 


>-----Original Message-----
>From: 
>bio_bulletin_board-bounces+mec=stowers-institute.org at bioinforma
>tics.org 
>[mailto:bio_bulletin_board-bounces+mec=stowers-institute.org at bi
>oinformatics.org] On Behalf Of Daniele Santoni
>Sent: Friday, July 28, 2006 6:39 AM
>To: bio_bulletin_board at bioinformatics.org
>Subject: [BiO BB] clustalw alignment pairwise
>
>Hi everybody, 
>
>We are aligning a sample sequence with a consensus sequence in 
>order to 
>identify mutations, deletions and insertions.
>Due to the presence of gaps we lack the correct open reading 
>frame as you 
>can see below (seqA). Can we solve the problem using some options of 
>clustalw? 
>
>This is an example:
>cons   TTAACCCCACTCTGTGTTACTTTAAATTGCACTGATTTGATGAATGCTACTAATACCAAT 60
>seqA   TTAACCCCACTCTGTGTTACTTTAAATTGTAATGGCACTCGAAACAGCACTCAAAACAGC 60
>       ***************************** * **        **    *** * * ** 
>
>cons   ACTACTATAATATATAGATGGAGAGGAGAAATAAAAAACTGCTCTTTCAATATCACCACA 120
>seqA   ACC-CTGGAA-----GAAAAGTCAGGGACAATACAAAACTGTTCTTTCAATATGACCACA 114
>       **  **  **       *  *  ***   **** ******* *********** ****** 
>
>Thank you in advance for every suggestions 
>
>Best regards 
>
>Daniele
>_______________________________________________
>Bioinformatics.Org general forum  -  
>BiO_Bulletin_Board at bioinformatics.org
>https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
>



More information about the BBB mailing list