[BiO BB] clustalw alignment pairwise
Cook, Malcolm
MEC at Stowers-Institute.org
Fri Jul 28 12:41:21 EDT 2006
Daniele,
Depending on how often you do this, and your computational and financial
resources, and what platforms you are comfortable with, you might
reconsider your approach.
I particular, I recommend that you consider to use Staden for your
project (http://staden.sourceforge.net/). It uses Gap4 or phrap under
the hood for assembly purposes, provides a few deffernt methods for
automatically scoring mutations
(http://staden.sourceforge.net/mutations/index.html), provides a gui to
view and curate the (sometimes incorrect) scoring in the context of the
actual traces, and provides a standard output format for reporting the
mutations that takes the ORF of a reference sequence into account for
reporting the consequence of the mutation in both html
(http://staden.sourceforge.net/mutations/index_short.html) and text
format, like this:
001321_11aF 33885T>Y (silent F) (strand - only)
001321_11aF 34407G>K (expressed E>[ED]) (strand - only)
001321_11cF 35512T>Y (silent L) (double stranded)
001321_11cF 35813C>Y (expressed P>[PL]) (double stranded)
001321_11dF 36314A>R (expressed E>[EG]) (double stranded)
001321_11eF 36749A>R (expressed K>[KR]) (double stranded)
001321_11eF 37313T>K (noncoding) (strand - only)
000256_11eF 36749A>G (expressed K>R) (double stranded)
(above from http://staden.sourceforge.net/mutations/index.html)
I've used it to good effect for all the above.
Regards,
Malcolm Cook
Database Applications Manager, Bioinformatics
Stowers Institute for Medical Research
>-----Original Message-----
>From:
>bio_bulletin_board-bounces+mec=stowers-institute.org at bioinforma
>tics.org
>[mailto:bio_bulletin_board-bounces+mec=stowers-institute.org at bi
>oinformatics.org] On Behalf Of Daniele Santoni
>Sent: Friday, July 28, 2006 6:39 AM
>To: bio_bulletin_board at bioinformatics.org
>Subject: [BiO BB] clustalw alignment pairwise
>
>Hi everybody,
>
>We are aligning a sample sequence with a consensus sequence in
>order to
>identify mutations, deletions and insertions.
>Due to the presence of gaps we lack the correct open reading
>frame as you
>can see below (seqA). Can we solve the problem using some options of
>clustalw?
>
>This is an example:
>cons TTAACCCCACTCTGTGTTACTTTAAATTGCACTGATTTGATGAATGCTACTAATACCAAT 60
>seqA TTAACCCCACTCTGTGTTACTTTAAATTGTAATGGCACTCGAAACAGCACTCAAAACAGC 60
> ***************************** * ** ** *** * * **
>
>cons ACTACTATAATATATAGATGGAGAGGAGAAATAAAAAACTGCTCTTTCAATATCACCACA 120
>seqA ACC-CTGGAA-----GAAAAGTCAGGGACAATACAAAACTGTTCTTTCAATATGACCACA 114
> ** ** ** * * *** **** ******* *********** ******
>
>Thank you in advance for every suggestions
>
>Best regards
>
>Daniele
>_______________________________________________
>Bioinformatics.Org general forum -
>BiO_Bulletin_Board at bioinformatics.org
>https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
>
More information about the BBB
mailing list