[BiO BB] question on RNA and species signatures
Mike Marchywka
marchywka at hotmail.com
Thu Jul 26 10:33:03 EDT 2007
Thanks. Nothing on the one site but ensembl has some ideas, not sure
how to interpret yet. fwiw, ncbi does have several repeats databases
http://www.ncbi.nlm.nih.gov/staff/tao/URLAPI/remote_accessible_blastdblist.html
and I tried against a few of these but no low-e hits.
At higher e, there were a few suggestions in human repeats:
$ blastnew -out non_dog -nuc -hits 10 -summ 3000 -db humrep -expect 100
TCCTGGAGTCCCAGGATCCAGTCCCACGTCGGGCTCCCT
>MER31-internal#LTR/MER4-group
Length = 4936
Score = 26.3 bits (13), Expect = 0.22
Identities = 13/13 (100%)
Strand = Plus / Minus
Query: 12 caggatccagtcc 24
|||||||||||||
Sbjct: 4369 caggatccagtcc 4357
I also ran against
some other wgs's and there are some lower e hits to cat but still
seems to be largely dog specific( matches 38/39 IIRC).
Thanks
Mike Marchywka
586 Saint James Walk
Marietta GA 30067-7165
404-788-1216 (C)<- leave message
989-348-4796 (P)<- emergency only
marchywka at hotmail.com
>From: "Tanney, Austin" <austin.tanney at almacgroup.com>
>Reply-To: "General Forum at Bioinformatics.Org"
><bio_bulletin_board at bioinformatics.org>
>To: "General Forum at Bioinformatics.Org"
><bio_bulletin_board at bioinformatics.org>
>Subject: RE: [BiO BB] question on RNA and species signatures
>Date: Thu, 26 Jul 2007 13:51:42 +0100
>
>Hi Mike,
>
>Have you tried looking at Rfam (http://www.sanger.ac.uk/Software/Rfam/)
>miRBase (http://microrna.sanger.ac.uk/sequences/) or the ensembl genome
>browser (http://www.ensembl.org/index.html)
>
>Thanks
>
>Austin
>
>
_________________________________________________________________
http://liveearth.msn.com
More information about the BBB
mailing list