[BiO BB] anyone have experience with un-annotated AFFX probes?

Mike Marchywka marchywka at hotmail.com
Sat May 26 09:22:28 EDT 2007


Hi,

I'm trying to follow up on results originally reported in

http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=pubmed&cmd=Retrieve&dopt=AbstractPlus&list_uids=16881841&query_hl=9&itool=pubmed_docsum

Am J Vet Res. 2006 Aug;67(8):1307-18.  Genomic expression patterns of mitral 
valve
tissues from dogs with degenerative mitral valve disease.Oyama MA, Chittur 
SV.

The authors reported this probe as being upregulated:
1586963 DG2−131f15 11.4

but even today it is not identified:

( you need to register but this is free)
https://www.affymetrix.com/analysis/netaffx/fullrecord.affx?pk=CANINE%3A1586963_AT


I'm trying to get any suggestive information on what this could possibly be.

There is no link to "probe set display" as suggested here,

http://www.affymetrix.com/support/technical/whitepapers/Sleuthing_NetAffx_whitepaper.pdf


I wrote a script to run blast searches on the reverse complements probes 
listed on the
above page and then found one human hit that turned up in most of the 
blasts,


http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nucleotide&val=116174854

If I grep for match locations I find that the hits are all reasonably close 
to
each other,
( I tested this on a grade A annotation and it did find all the probes )
$ cat *.out | grep -A 10 ">.*AC004686"| grep Sbjct | sort -g  -k 2
Sbjct: 109088 aggaacagatgtccaatgtttc 109109
Sbjct: 109124 ttgtggatttggctgacaaac 109144
Sbjct: 109137 tgacaaactctctaagctgcattt 109160
Sbjct: 109168 gttcccatagagtcagctagccact 109192
Sbjct: 109264 tcaaatgaatccagggtg 109281
Sbjct: 109376 tagtgggtcaaagagaatgagcaaa 109400
Sbjct: 109393 tgagcaaacagttggcacctgcc 109415
Sbjct: 109437 taaaggcaatgagtaagcagct 109458
Sbjct: 109527 tttgctgcaattcaaggcctc 109547


Hoping this may be a feature of the dog genome that for whatever
reason was missed, I decide to investigate further.
So, I cut an enclosing sequence from the NCBI entry,

109081 aattaagagg aacagatgtc caatgtttca aaaagccaca catttgtgga tttggctgac
  109141 aaactctcta agctgcattt tatttctgtt cccatagagt cagctagcca cttgcaactg
  109201 actcacttct ctctgggcca cagtttgggc cagtctcctg actacagaat tagaatccag
  109261 atatcaaatg aatccagggt gcttgggtgg agagcaggtg ttaaaagcca tctaaaacca
  109321 ccccttccct gctttaattt aggagtatca acacccacac agcaaactgc aaggctagtg
  109381 ggtcaaagag aatgagcaaa cagttggcac ctgccaatcc cagcaccacg caattttaaa
  109441 ggcaatgagt aagcagctgt ctggaacagg tttttgtata atccttctta agagtactgg
  109501 ttaaatatgc aaatacacac aggttatttg ctgcaattca aggcctcgcc cccaaggcaa

and tried to run a translated blast.
First, it is worth noting that running clustalw against the AFFX target 
sequence (reverse complement ) showed a reasonable match to the above 
sequence I pulled out.



While blast did find the above entry in various reading frames,
nothing else of significance turned up. Any thoughts on a way to
proceed? I have a ribosome script and will try various translations and see
if an automated function prediction system can notice anything.
Conserved domain searches on some of the above blast hits didn't
turn up anything. Perhaps if I take a cleaner section of the gene I could
get something more meaningful?
Maybe I should download the IGB and play with the transcript a little?

Thoughts or better approaches?
Thanks.

I sent a similar request to Affymetrix support- they have been very helpful 
in
checking my earlier efforts and they provide a lot of great support
but I thought someone here may be able to help as they are probably gone
for the weekend.



Mike Marchywka
586 Saint James Walk
Marietta GA 30067-7165
404-788-1216 (C)<- leave message
989-348-4796 (P)<- emergency only
marchywka at hotmail.com

_________________________________________________________________
Like the way Microsoft Office Outlook works? You’ll love Windows Live 
Hotmail. 
http://imagine-windowslive.com/hotmail/?locale=en-us&ocid=TXT_TAGHM_migration_HM_mini_outlook_0507




More information about the BBB mailing list