.. _getting-started:

Getting Started Guide
=====================
This guide is intended as a reference for those using VLinux for the first 
time. Instructions are provided for download and testing. 
There are also notes on accessing the various programs that come with the
latest release.

.. toctree::
   :maxdepth: 2

Download
--------
The live DVD iso image can be downloaded from the :ref:`download` page

Create the DVD 
--------------
The iso file should be burnt as an **image** using your DVD writing software.
If you are using Linux, you can use K3B or Brasero. On Windows you can use 
`InfraRecorder <http://infrarecorder.org/>`_

.. note::
        When you burn the image, please use the *disc-at-once* option instead
        of *track-at-once*

Brasero
.......


.. figure:: images/brasero-burn-image.png
   :alt: Write iso image using Brasero

InfraRecorder
.............


.. figure:: images/infrarecorder-burn-image.png
   :alt: Write iso image using InfraRecorder

   Use the **Write Image** option in InfraRecorder to burn the iso

Boot from DVD
-------------
With the DVD in the drive, restart your computer and choose to boot from DVD
instead of the hard disk. On most systems, this can be done by using a 
special key like **F9** or **F12**. This will be displayed at boot. If this
is not the case, modify the boot order in the BIOS by entering setup (**F2**
or **DEL** mostly).

.. note::
   This process does not change existing data on your hard disk. If you 
   change the boot order in the BIOS, you can always revert it to the
   default.

Once the booting from DVD is successful, the login screen would be displayed.

Logging in
----------
A default user has already been setup in the appliance. The login details
for user and the root user/Administrator is below

.. csv-table::
   :header: "User", "Username", "Password"

   Default user, vlinux, vlinux
   Administrator, root, linux


Test some applications
----------------------
Here are some applications you would want to try after logging in

EMBOSS
......
Launch Firefox and visit http://localhost/emboss. This will present
the emboss-explorer interface to EMBOSS. You can test some programs
by selecting them from the panel on the left.

.. note::
   The first time when Firefox is launched, there will be a prompt
   to setup Zotero. Please accept the defaults here to complete
   the setup.

Sequence Manipulation Suite
...........................
Launch Firefox and visit http://localhost/sms2

NCBI BLAST
..........
Launch Firefox and visit http://localhost/blast. You can then choose
`Regular BLAST without client-server support`. Try doing a BLAST 
searching using the sequence below ::

   CCCTGATACGGGTGATTCAGGTCATACAGTTCGACGCCAAATTCTTTGCAGTTTTTGATCAGTTCCTGCA
   TCTGGATACGCGCCATTTCACCGCAGGCATTAATGTCTTTGGTCTGGGTAGAGACGTTGTGATCCATGGT
   AGCGAAGGTTTTGCCCGGCTGACGTACCGGGCGACCGTGGGCGCGCAGACCATCGAACGCCTGCGGTGAG
   GTCACTTCATGCACCAGGTGGCGGTCGATATATAACAGTGGGGTTTCGTTTTCGGCTTCGTACACAACGT
   GAGCGTCGAACAATTTTTCGTATAACGTCTTAGCCATGATTACACCCCTTCTGCTACATAGCGGGCAATG
   ATATCGCCCATTTCATCGGTACTAACGGCGGCAGCGCCACGGGCTAAATCCCCGGTGCGAATGCCTTCTT

Rasmol
......
Open GNOME Terminal found under `More Applications` in the main menu 
and then type ``rasmol``. This will launch Rasmol. Load a PDB file using 
:menuselection:`File --> Open`. This will prompt for a PDB file name in GNOME
Terminal from where RasMol was launced. You can try loading the PDB file 
below as an example ::
        
        /usr/share/python-biopython/Tests/PDB/1A8O.pdb

ClustalX
........
Open GNOME Terminal and type ``clustalx2``. Use the 
:menuselection:`Load sequences` to load sequences from file. You can

* download a multi-fasta format file or 
* copy the example file 
  :file:`/usr/share/doc/packages/python-biopython/Doc/examples/opuntia.fasta` 
  from the BioPython package to /home/vlinux
  
Do an alignment using :menuselection:`Alignment --> Do Complete Alignment`