Home
Who am I
Technology
EST Assembly
Contact

These datas are free for academic use only, please contact me for any other use.

Takifugu rubripes
cluster # 482 cluster # 482       Sequences # 2       consensus # 2


see consensus multiple alignment with clustalw

Direct access to contigs :
consensus_482#0 length = 439 sequences # 1  
consensus_482#1 length = 416 sequences # 1  

consensusID : consensus_482#0
NCBI blastX ! send the sequence to the NCBI site !
NCBI blastN ! send the sequence to the NCBI site !
Sequences nbr = 1
consensus length = 439
fasta sequence
                              [TTTGAAAGCTTTATTTATCCAGGTGAGTTAAATAAAAACAAATTCTTACTTACAAGGGAGACCTGTGGGTCAACAGAATGTTGGTGATTTTTAAAAAGAATAACTTGATTAACGAGATTATTGCAAATTTAGACATTTTCGTTCATGTACAATCCTTCTGTGGAACCTTGTGGTTTTGTGTGAAATCAATTGTTTTAGATCTTTCCATGTTTCAAGTTACAACCTTGTTTTTTTTTTGCAGGACCAAAGTGAAGGATGGAGAGATGAAGGCCTGCCTCAGATGGCTCGCAAACTTCCATGCTCTCTTCCTGGGAGTAGTGCCAGAAAATCTGTGGCCTGTTGGGACCTACTGGCACCTGGAGACTCGGCCGGACGAGTTGGAGGCCATGGATCATCCCAAACTCAAAGCGGCTGCTGGAGAGATTGACAGGATTCTAAG]

[+] EMBL CA332232             [TTTGAAAGCTTTATTTATCCAGGTGAGTTAAATAAAAACAAATTCTTACTTACAAGGGAGACCTGTGGGTCAACAGAATGTTGGTGATTTTTAAAAAGAATAACTTGATTAACGAGATTATTGCAAATTTAGACATTTTCGTTCATGTACAATCCTTCTGTGGAACCTTGTGGTTTTGTGTGAAATCAATTGTTTTAGATCTTTCCATGTTTCAAGTTACAACCTTGTTTTTTTTTTGCAGGACCAAAGTGAAGGATGGAGAGATGAAGGCCTGCCTCAGATGGCTCGCAAACTTCCATGCTCTCTTCCTGGGAGTAGTGCCAGAAAATCTGTGGCCTGTTGGGACCTACTGGCACCTGGAGACTCGGCCGGACGAGTTGGAGGCCATGGATCATCCCAAACTCAAAGCGGCTGCTGGAGAGATTGACAGGATTCTAAG]


>consensus_482#0 TTTGAAAGCTTTATTTATCCAGGTGAGTTAAATAAAAACAAATTCTTACTTACAAGGGAG ACCTGTGGGTCAACAGAATGTTGGTGATTTTTAAAAAGAATAACTTGATTAACGAGATTA TTGCAAATTTAGACATTTTCGTTCATGTACAATCCTTCTGTGGAACCTTGTGGTTTTGTG TGAAATCAATTGTTTTAGATCTTTCCATGTTTCAAGTTACAACCTTGTTTTTTTTTTGCA GGACCAAAGTGAAGGATGGAGAGATGAAGGCCTGCCTCAGATGGCTCGCAAACTTCCATG CTCTCTTCCTGGGAGTAGTGCCAGAAAATCTGTGGCCTGTTGGGACCTACTGGCACCTGG AGACTCGGCCGGACGAGTTGGAGGCCATGGATCATCCCAAACTCAAAGCGGCTGCTGGAG AGATTGACAGGATTCTAAG



consensusID : consensus_482#1
NCBI blastX ! send the sequence to the NCBI site !
NCBI blastN ! send the sequence to the NCBI site !
Sequences nbr = 1
consensus length = 416
fasta sequence
                              [GTACCAGGATATTGTCCTGCAGGCGTGCAGAGCTTGAGTGGCTGCATGTGGGTGCAAAGATCCAAACTCTGTGGAGCGGGTACGGAGAGATAGTCCGGCTCCACCTGGAGGGTGGTGAGCGGCCCTCCGTCATTGTCAAACATGTCAAGTTTCCAGCCGAAGCTGAACATCCAGGCGGCAGGAACACAAACCATTCACACCTGCGTAAAGTGAGGTCATACCAGGTGGAGACATACTGGTACCAGAACTATTTCACTAATCAGGGTTGGCGGATCCCTGCCTGCCTGGCTGCCTATTCCCACGGAGACGAGATGCTGATGGNGTTAGAGGATCTGGATGCAGCCGGTTATAGTCAGAGAAGGACCAAAGTGAAGGATGGAGAGATGAAGGCCTGCCTCAGATGGCTCGCAAAACTT]

[+] EMBL FR0063581            [GTACCAGGATATTGTCCTGCAGGCGTGCAGAGCTTGAGTGGCTGCATGTGGGTGCAAAGATCCAAACTCTGTGGAGCGGGTACGGAGAGATAGTCCGGCTCCACCTGGAGGGTGGTGAGCGGCCCTCCGTCATTGTCAAACATGTCAAGTTTCCAGCCGAAGCTGAACATCCAGGCGGCAGGAACACAAACCATTCACACCTGCGTAAAGTGAGGTCATACCAGGTGGAGACATACTGGTACCAGAACTATTTCACTAATCAGGGTTGGCGGATCCCTGCCTGCCTGGCTGCCTATTCCCACGGAGACGAGATGCTGATGGNGTTAGAGGATCTGGATGCAGCCGGTTATAGTCAGAGAAGGACCAAAGTGAAGGATGGAGAGATGAAGGCCTGCCTCAGATGGCTCGCAAAACTT]


>consensus_482#1 GTACCAGGATATTGTCCTGCAGGCGTGCAGAGCTTGAGTGGCTGCATGTGGGTGCAAAGA TCCAAACTCTGTGGAGCGGGTACGGAGAGATAGTCCGGCTCCACCTGGAGGGTGGTGAGC GGCCCTCCGTCATTGTCAAACATGTCAAGTTTCCAGCCGAAGCTGAACATCCAGGCGGCA GGAACACAAACCATTCACACCTGCGTAAAGTGAGGTCATACCAGGTGGAGACATACTGGT ACCAGAACTATTTCACTAATCAGGGTTGGCGGATCCCTGCCTGCCTGGCTGCCTATTCCC ACGGAGACGAGATGCTGATGGNGTTAGAGGATCTGGATGCAGCCGGTTATAGTCAGAGAA GGACCAAAGTGAAGGATGGAGAGATGAAGGCCTGCCTCAGATGGCTCGCAAAACTT



consensus multiple alignement with clustalw

CLUSTAL W (1.82) multiple sequence alignment


consensus_482#0      -TTTGAAAGCTTTATTTATCCAGGTGAGTTAAATAAAAACAAATTCTTACTTACAAGGGA 59
consensus_482#1      GTACCAGGATATTGTCC-TGCAGGCGTGCAGAGCTTGAGTGGCTGCATGTGGGTGCAA-A 58
                      *   *     ** *   * **** * *   *     *     * * *           *

consensus_482#0      GACCTGTGGGTCAACAGAATGTTGGTGATTTTTAAAAAGAATAACTTGATTAACGAGATT 119
consensus_482#1      GATCCA-AACTCTGTGGAGCG--GGT-ACGGAGAGATAGTCCGGCTCCACCTGGAGGGTG 114
                     ** *      **    **  *  *** *     * * **     **  *       * * 

consensus_482#0      ATTGCAAAT--TTAGACATTTTCGTTCATGTACAATCCTTCTGTGGAACCTTGTGGTTTT 177
consensus_482#1      GTGAGCGGCCCTCCGTCATTGTCAAACATGT-CAAGTTTCCAGCCGAAGCTGAACATCCA 173
                      *         *  * **** **   ***** ***   * * *  *** **     *   

consensus_482#0      G----TGTGAAATCAATTGTTTTAGATCTTTCCATGTTTCAAGTTACAACCTT----GTT 229
consensus_482#1      GGCGGCAGGAACACAAACCATTCACACCTGCGTAAAGTG-AGGTCATACCAGGTGGAGAC 232
                     *       ***  ***    ** * * **    *   *  * ** * * *       *  

consensus_482#0      TTTTTTTTGCAGGACCAAAGTGAAGGATGGAGA--GATGAAGGCCTGCCTCAGATGGCTC 287
consensus_482#1      ATACTGGTACCAGAACTATTTCACTAATCAGGGTTGGCGGATCCCTGCCT-GCCTGGCT- 290
                      *  *  * *  ** * *  * *   **   *   *  * *  *******    ***** 

consensus_482#0      GCAAACTTCCATGCTCTCTTCCTGGGAGTAGTGCCAGAAAATCTGTGGCCTGTTGGGACC 347
consensus_482#1      GCCTATTCCCACGGAGACGAGATGCTGATGGNGTTAGAGGATCTGGATGCAGCCGG---T 347
                     **  * * *** *    *    **    * * *  ***  *****    * *  **    

consensus_482#0      TACTGGCACCTGGAGACTCGGCCGGACGAGTTGGAGGCCATGGATCATCCCAAACTCAAA 407
consensus_482#1      TATAGTCAGAGAAGGACCAAAGTGAAGGATGGAGAGATGAAGGCCTGCCTCAGATGGCTC 407
                     **  * **      ***      * * **    ***   * **     * ** *      

consensus_482#0      GCGGCTGCTGGAGAGATTGACAGGATTCTAAG 439
consensus_482#1      GCAAAACTT----------------------- 416
                     **      *                       




Data build on Sat Aug 9 00:50:02 CEST 2003 by Hubert Wassner    (hubert.wassner@noos.fr)