These datas are free for academic use only, please contact me for any other use. Takifugu rubripes see consensus multiple alignment with clustalw Direct access to contigs :
consensusID : consensus_743#0 NCBI blastX ! send the sequence to the NCBI site ! NCBI blastN ! send the sequence to the NCBI site ! Sequences nbr = 1 consensus length = 109 fasta sequence [TGATTTGCATTTCATATTCTGTTCAAGGACTTTAGGGGATGCTTGAGCTCTGATTATCAAATATGTAGATTTTCAGGTGAATTAAGGAAATGTATTAAAATAAGAGCCA] [+] EMBL CA846572 [TGATTTGCATTTCATATTCTGTTCAAGGACTTTAGGGGATGCTTGAGCTCTGATTATCAAATATGTAGATTTTCAGGTGAATTAAGGAAATGTATTAAAATAAGAGCCA] clustalw multiple alignements is not computed in this case |
Data build on Sat Aug 9 00:50:02 CEST 2003 by Hubert Wassner (hubert.wassner@noos.fr) |