These datas are free for academic use only, please contact me for any other use. Schistosoma mansoni see consensus multiple alignment with clustalw Direct access to contigs :
consensusID : consensus_3893#0 NCBI blastX ! send the sequence to the NCBI site ! NCBI blastN ! send the sequence to the NCBI site ! Sequences nbr = 2 consensus length = 64 fasta sequence [TCGACCCTTGATTTCTATTCGTTGATTGATAAGGACAGTGTCTCACCCGAGTCGTCGTTCGTCG] [+] EMBL SMAA98620 [TCGACCCTTGATTTCTATTCGTTGATTGATAAGGACAGTGTCTCACCCGAGTCGTCGTTCGTCG] [+] EMBL AA952310 [tgcACCCTTGATTTCTATTCGTTGATTGATAAGGACAGTGTCTCACCCGAGTCGTCGTTCGTCG] clustalw multiple alignements is not computed in this case |
Copyright Thu Nov 6 12:32:27 CET 2003 Hubert Wassner (hubert.wassner@noos.fr) | ||||