[Bioclusters] ncbi blast
Steve O
bioclusters@bioinformatics.org
Fri, 18 Jun 2004 07:21:15 -0700
Hi,
I was running into similar problems with dual athlons.
Run memtest86 overnight and likely you'll have test 5 fail.
http://www.memtest86.com/#trouble
Removing some sticks of ram fixed my errors.
-steve
Chris Dwan wrote:
>
> Justin,
>
> I've poked around a bit, and run your queries on a variety of machines
> (P-III and Athalon...as well as a few others) which I have sitting
> around the shop here. I was unable to replicate your observed behavior.
>
> The main difference between my test machines and yours is that I only
> have 2GB of RAM. That, and your observed intermittent behavior makes me
> suspect some sort of evil high-memory behavior is behind your core
> dump. Because you're able to replicate it on various machines, it's
> most likely not a bad memory chip. There are a lot of kernel / extended
> memory gurus on this list. I'd love to hear their thoughts.
>
> You are correct that thousands of us run millions of BLASTs vs. NCBI
> formatted NT every day...however there have been several instances where
> a particular hardware / query combination is rare enough that only a few
> people ever see it. What's more fun (to my mind) is the ratio of people
> whose results are erroneous to those who notice the problem. Depending
> on your parser, job failed to run ~= no hits found.
>
> Good luck with this.
>
> -Chris Dwan
>
> On Jun 16, 2004, at 10:46 AM, Justin Powell wrote:
>
>>
>> Hi Chris
>>
>> A short query which goes wrong is
>>
>> actacgactagcatcagctacgctagatgactacgatcagctacgactagcatcgactacg
>>
>> I just have this in a text file on its own with no name line. The nt
>> database I'm using is from the ncbi ftp site blast/db directory and the
>> unzipped database files have the date June 11 2004.
>>
>> I've found the intermittency varies. Sometimes it seems it can be
>> provoked
>> by running a blast against est first, and sometimes it seems to work
>> correctly time after time.
>>
>> A second longer sequence I've had go wrong is
>>
>> TCCCCCGAATTTAAACGCGTTGAAAGGGTCATCCTTACTAGAAAAGAGAGTTG
>> ATTCTCTCCGACAGCTTAACACTACCACGGTTAACCAGCTGCTGGGGTTGCCGGGGATGACCTCTACATT
>> CACGGCTCCGCAACTGTTGCAGTTAAGAATAATAGCTATAACTGCGTCTGCCGTGTCCCTTATTGCCGGT
>> TGCCTCGGAATGTTCTTCCTTTCTAAAATGGATAAGAGACGAAAAGTCTTCAGACATGATCTCATCGCAT
>> TTTTGATAATTTGCGACTTTCTTAAAGCTTTTATTCTGATGATTTATCCCATGATTATCCTTATTAATAA
>> TAGTGTGTATGCAACACCTGCATTTTTTAATACCTTGGGTTGGTTTACGGCCTTTGCCATCGAAGGTGCA
>> GACATGGCCATAATGATATTCGCCATACATTTTGCTATTTTGATCTTCAAGCCTAATTGGAAATGGCGAA
>> ATAAAAGATCGGGAAATATGGAGGGTGGCTTGTACAAAAAAAGGTCATATATCTGGCCAATTACTGCATT
>> AGTACCTGCCATTTTAGCAAGCTTAGCCTTCATTAATTATAATAAACTCAATGACGATTCTGACACCACT
>> ATTATACTGGATAATAATAACTACAACTTTCCCGATTCTCCCAGGCAAGGTGGCTACAAACCTTGGAGTG
>> CATGGTGCTATTTACCACCCAAGCCGTACTGGTATAAAATTGTTTTAAGCTGGGGTCCCAGATATTTCAT
>> TATTATTTTCATATTTGCAGTCTACCTCAGTATTTATATTTTCATTACCAGTGAAAGTAAAAGAATTAAA
>> GCGCAAATTGGAGACTTTAACC
>>
>>
>> I've tried recompiling with the -g flag on (and the -O3 flag off) and run
>> gdb on the coredump. However I'm not a c programmer (though I did once
>> read a book on it) and am not at all familiar with either C, gdb or even
>> the details of the call stack, so I'm not sure I've done all this
>> correctly. An example backtrace is like this, though others I've had
>> looked different:
>>
>> [root@prada bin]# gdb blastall core.9520
>> GNU gdb Red Hat Linux (5.3post-0.20021129.18rh)
>> Copyright 2003 Free Software Foundation, Inc.
>> GDB is free software, covered by the GNU General Public License, and you
>> are
>> welcome to change it and/or distribute copies of it under certain
>> conditions.
>> Type "show copying" to see the conditions.
>> There is absolutely no warranty for GDB. Type "show warranty" for
>> details.
>> This GDB was configured as "i386-redhat-linux-gnu"...
>> Core was generated by `./blastall -p blastn -a 2 -d /usr/blasttest/nt -i
>> /usr/blasttest/tempdna'.
>> Program terminated with signal 11, Segmentation fault.
>> Reading symbols from /lib/tls/libm.so.6...done.
>> Loaded symbols for /lib/tls/libm.so.6
>> Reading symbols from /lib/tls/libpthread.so.0...done.
>> Loaded symbols for /lib/tls/libpthread.so.0
>> Reading symbols from /lib/tls/libc.so.6...done.
>> Loaded symbols for /lib/tls/libc.so.6
>> Reading symbols from /lib/ld-linux.so.2...done.
>> Loaded symbols for /lib/ld-linux.so.2
>> Reading symbols from /lib/libnss_files.so.2...done.
>> Loaded symbols for /lib/libnss_files.so.2
>> #0 0x0805ea52 in BlastNtWordFinder (search=0x84363e8, lookup=0x842e6b8)
>> at blast.c:9265
>> 9265 next_lindex = (((lookup_index) &
>> mask)<<char_size) + *(s+1);
>> (gdb) backtrace
>> #0 0x0805ea52 in BlastNtWordFinder (search=0x84363e8, lookup=0x842e6b8)
>> at blast.c:9265
>> #1 0x0805a473 in BlastWordFinder (search=0x84363e8) at blast.c:6847
>> #2 0x0805a336 in BlastExtendWordSearch (search=0x84363e8,
>> multiple_hits=0 '\0') at blast.c:6803
>> #3 0x08059d7c in BLASTPerformFinalSearch (search=0x84363e8,
>> subject_length=117793,
>> subject_seq=0x7e12b129 <Address 0x7e12b129 out of bounds>) at
>> blast.c:6612
>> #4 0x080596c8 in BLASTPerformSearch (search=0x84363e8,
>> subject_length=117793,
>> subject_seq=0x7e12b129 <Address 0x7e12b129 out of bounds>) at
>> blast.c:6365
>> #5 0x0805967b in BLASTPerformSearchWithReadDb (search=0x84363e8,
>> sequence_number=1629625) at blast.c:6344
>> #6 0x0805066f in do_blast_search (ptr=0x84363e8) at blast.c:3335
>> #7 0x0804d600 in NlmThreadWrapper (wrapper_arg=0x8439c80) at
>> ncbithr.c:647
>> #8 0x400522b6 in start_thread () from /lib/tls/libpthread.so.0
>> (gdb) quit
>>
>>
>> Hopefully this is some use.
>>
>> Justin
>>
>>
>> On Wed, 16 Jun 2004, Chris Dwan wrote:
>>
>>>
>>> Please forward an example of the error-provoking query sequence. I'm
>>> curious to see if I can replicate this behavior.
>>>
>>> -Chris Dwan
>>> University of Minnesota
>>>
>>>> I'm experiencing trouble with blastall 2.2.9 running blastn on a linux
>>>> cluster against a recently downloaded version of the 'nt' database from
>>>> ncbi. Intermittently I get a segmentation fault partway through the
>>>> search.
>>>>
>>>> This happens both with precompiled blast and blast I compile myself. It
>>>> happens on a two dual xeon systems running redhat9.0 and a dual athlon
>>>> system running redhat7.1. Both systems have 4GB ram. It happens with
>>>> several different query sequences, but never with the est nucleotide
>>>> database. It also happens if I use fastacmd to dump the ncbi nt
>>>> database
>>>> into fasta format and then formatdb it myself. Blastdbs are kept
>>>> locally
>>>> so its not a networking issue.
>>>>
>>>> Strangely this also happens with blastall2.2.6 on the athlon system,
>>>> I've
>>>> not tested it on the xeon systems (or other releases).
>>>>
>>>> So I would guess, given the variety of systems, that its a bug which nt
>>>> provokes specifically - but then I assume huge numbers of people must
>>>> use
>>>> blast to search nt on linux boxes and would have noticed already if
>>>> this
>>>> were the case. Anyone have any ideas what might be going on?
>>>>
>>>>
>>>> Justin
>>>> jacp1@mole.bio.cam.ac.uk
>>>>
>>>> _______________________________________________
>>>> Bioclusters maillist - Bioclusters@bioinformatics.org
>>>> https://bioinformatics.org/mailman/listinfo/bioclusters
>>>>
>>>
>>> _______________________________________________
>>> Bioclusters maillist - Bioclusters@bioinformatics.org
>>> https://bioinformatics.org/mailman/listinfo/bioclusters
>>>
>>
>
> _______________________________________________
> Bioclusters maillist - Bioclusters@bioinformatics.org
> https://bioinformatics.org/mailman/listinfo/bioclusters
>