[Bioclusters] blast 2.2.9 issues with expect value (-e)
Joe Landman
bioclusters@bioinformatics.org
Fri, 25 Jun 2004 14:57:27 -0400
Hi Bonnie:
Could you share the sequence and one of the lines in the DB that matches?
Joe
BHurwitz@twt.com wrote:
>Hi,
>
>I just updated my blast from 2.2.6 to 2.2.9 and am suddenly getting very
>strange results. Sequences are appearing to have the same expect value
>although the matches in the hsp are very different. I am wondering if any
>one has seen a similar issue. I am also finding that if I set the -e
>option to be higher, I can even get matches with just four bases, although
>I have a word size of seven. Something is going very wrong!
>
>Here are the stats on my machine and blast command + example output:
>
>dual xeon 2.8 GHz, 4GB RAM, OS, RH linux: enterprise 3.0, kernel 2.4.21-9
>
>options on the blast command line: -W 7, -e 1, -i input, -o output , -d
>myinternalblastdb, --p blastn
>
>I'm using precompliled 2.2.9 from the NCBI.
>
>
>>From blast:
>
>
>
>>5846704
>>
>>
> Length = 177
>
> Score = 24.3 bits (12), Expect = 0.16
> Identities = 18/20 (90%)
> Strand = Plus / Minus
>
>Query: 13 ctccagacattgggcgggtt 32
> |||||| ||||| |||||||
>Sbjct: 127 ctccaggcattgagcgggtt 108
>
>
>
>
>>5714596
>>
>>
> Length = 9401
>
> Score = 24.3 bits (12), Expect = 0.16
> Identities = 8/20 (40%)
> Strand = Plus / Minus
>
>
>Query: 13 ctccagacattgggcgggtt 32
> | ||| | |||
>Sbjct: 202 tccaagaaaggacccggtcg 183
>
>-Bonnie
>
>
>
>_______________________________________________
>Bioclusters maillist - Bioclusters@bioinformatics.org
>https://bioinformatics.org/mailman/listinfo/bioclusters
>
>
--
Joseph Landman, Ph.D
Scalable Informatics LLC,
email: landman@scalableinformatics.com
web : http://scalableinformatics.com
phone: +1 734 612 4615