|
These datas are free for academic use only, please contact me for any other use. Oryza sativa see consensus multiple alignment with clustalw Direct access to contigs :
consensusID : consensus_12945#0 NCBI blastX ! send the sequence to the NCBI site ! NCBI blastN ! send the sequence to the NCBI site ! Sequences nbr = 1 consensus length = 42 fasta sequence
[AAGAAGTGATGATTCTGGTGCTGGGTAGCCAGAAAGCACTGG]
[+] EMBL CF338367 [AAGAAGTGATGATTCTGGTGCTGGGTAGCCAGAAAGCACTGG]
clustalw multiple alignements is not computed in this case |
| Copyright Mon Feb 16 12:49:02 CET 2004 Hubert Wassner (hubert.wassner@noos.fr) | ||||