[BiO BB] Search reverse repeat

[Zhang, Yuanji]

Which similarity search program will align reverse repeats in the genome?
For example, if I have 2 sequences, 
>Seq A
AATCATCAATCAGCCACTACCAAAAAATGCTCTCTGGAGTTGGTTTTCTTTTATTGATAC

and 

>Seq B
CATAGTTATTTTCTTTTGGTTGAGGTCTCTCGTAAAAAACCATCACCGACTAACTACTAA

Seq A and Seq B are reverse repeats to each other. 

BLAST does not align A and B. 

I can manipulate the sequences by reversing one seq and then align, but I'd
like to know whether there is a program that align A and B without extra
sequence manipulation. Any information is appreciated.