[BiO BB] Search reverse repeat - Bayesian Filter detected spam

[Tanney, Austin]

Run BLAST ensuring that you use the "reverse complement" BLAST. I am pretty sure most versions of BLAST have this
If you are just interested in BLASTing two sequences specifically against one another use this
http://www.ncbi.nlm.nih.gov/blast/bl2seq/bl2.html

Cheers

Austin

> -----Original Message-----
> From: Zhang, Yuanji [mailto:yjzhang at noble.org]
> Sent: 01 June 2004 16:47
> To: 'bio_bulletin_board at bioinformatics.org'
> Subject: [SPAM] - [BiO BB] Search reverse repeat - Bayesian Filter
> detected spam
> 
> 
> Which similarity search program will align reverse repeats in 
> the genome?
> For example, if I have 2 sequences, 
> >Seq A
> AATCATCAATCAGCCACTACCAAAAAATGCTCTCTGGAGTTGGTTTTCTTTTATTGATAC
> 
> and 
> 
> >Seq B
> CATAGTTATTTTCTTTTGGTTGAGGTCTCTCGTAAAAAACCATCACCGACTAACTACTAA
> 
> Seq A and Seq B are reverse repeats to each other. 
> 
> BLAST does not align A and B. 
> 
> I can manipulate the sequences by reversing one seq and then 
> align, but I'd
> like to know whether there is a program that align A and B 
> without extra
> sequence manipulation. Any information is appreciated.
> _______________________________________________
> BiO_Bulletin_Board maillist  -  BiO_Bulletin_Board at bioinformatics.org
> https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
>