[BiO BB] Search reverse repeat - Bayesian Filter detected spam

[Martin Gollery]

I don't believe the reverse complement idea will work, because these two 
sequences are reversed, but not complements. What you could do is use a 
script to complement them, then run Blast with reverse complement 
switched on.

Tanney, Austin wrote:

> Run BLAST ensuring that you use the "reverse complement" BLAST. I am pretty sure most versions of BLAST have this
> If you are just interested in BLASTing two sequences specifically against one another use this
> http://www.ncbi.nlm.nih.gov/blast/bl2seq/bl2.html
> 
> Cheers
> 
> Austin
> 
> 
>>-----Original Message-----
>>From: Zhang, Yuanji [mailto:yjzhang at noble.org]
>>Sent: 01 June 2004 16:47
>>To: 'bio_bulletin_board at bioinformatics.org'
>>Subject: [SPAM] - [BiO BB] Search reverse repeat - Bayesian Filter
>>detected spam
>>
>>
>>Which similarity search program will align reverse repeats in 
>>the genome?
>>For example, if I have 2 sequences, 
>>
>>>Seq A
>>
>>AATCATCAATCAGCCACTACCAAAAAATGCTCTCTGGAGTTGGTTTTCTTTTATTGATAC
>>
>>and 
>>
>>
>>>Seq B
>>
>>CATAGTTATTTTCTTTTGGTTGAGGTCTCTCGTAAAAAACCATCACCGACTAACTACTAA
>>
>>Seq A and Seq B are reverse repeats to each other. 
>>
>>BLAST does not align A and B. 
>>
>>I can manipulate the sequences by reversing one seq and then 
>>align, but I'd
>>like to know whether there is a program that align A and B 
>>without extra
>>sequence manipulation. Any information is appreciated.
>>_______________________________________________
>>BiO_Bulletin_Board maillist  -  BiO_Bulletin_Board at bioinformatics.org
>>https://bioinformatics.org/mailman/listinfo/bio_bulletin_board
>>
> 
> _______________________________________________
> BiO_Bulletin_Board maillist  -  BiO_Bulletin_Board at bioinformatics.org
> https://bioinformatics.org/mailman/listinfo/bio_bulletin_board

-- 
Martin Gollery
Associate Director
Center For Bioinformatics
University of Nevada at Reno
Dept. of Biochemistry / MS330
775-784-7042
-----------
Marty's Law- the number of Bioinformatics acronyms will double every 18 
months.