Getting Started Guide

This guide is intended as a reference for those using VLinux for the first time. Instructions are provided for download and testing. There are also notes on accessing the various programs that come with the latest release.

Download

The live DVD iso image can be downloaded from the Download page

Create the DVD

The iso file should be burnt as an image using your DVD writing software. If you are using Linux, you can use K3B or Brasero. On Windows you can use InfraRecorder

Note

When you burn the image, please use the disc-at-once option instead of track-at-once

Brasero

InfraRecorder

Use the Write Image option in InfraRecorder to burn the iso

Boot from DVD

With the DVD in the drive, restart your computer and choose to boot from DVD instead of the hard disk. On most systems, this can be done by using a special key like F9 or F12. This will be displayed at boot. If this is not the case, modify the boot order in the BIOS by entering setup (F2 or DEL mostly).

Note

This process does not change existing data on your hard disk. If you change the boot order in the BIOS, you can always revert it to the default.

Once the booting from DVD is successful, the login screen would be displayed.

Logging in

A default user has already been setup in the appliance. The login details for user and the root user/Administrator is below

User	Username	Password
Default user	vlinux	vlinux
Administrator	root	linux

Test some applications

Here are some applications you would want to try after logging in

EMBOSS

Launch Firefox and visit http://localhost/emboss. This will present the emboss-explorer interface to EMBOSS. You can test some programs by selecting them from the panel on the left.

Note

The first time when Firefox is launched, there will be a prompt to setup Zotero. Please accept the defaults here to complete the setup.

Sequence Manipulation Suite

Launch Firefox and visit http://localhost/sms2

NCBI BLAST

Launch Firefox and visit http://localhost/blast. You can then choose Regular BLAST without client-server support. Try doing a BLAST searching using the sequence below

CCCTGATACGGGTGATTCAGGTCATACAGTTCGACGCCAAATTCTTTGCAGTTTTTGATCAGTTCCTGCA
TCTGGATACGCGCCATTTCACCGCAGGCATTAATGTCTTTGGTCTGGGTAGAGACGTTGTGATCCATGGT
AGCGAAGGTTTTGCCCGGCTGACGTACCGGGCGACCGTGGGCGCGCAGACCATCGAACGCCTGCGGTGAG
GTCACTTCATGCACCAGGTGGCGGTCGATATATAACAGTGGGGTTTCGTTTTCGGCTTCGTACACAACGT
GAGCGTCGAACAATTTTTCGTATAACGTCTTAGCCATGATTACACCCCTTCTGCTACATAGCGGGCAATG
ATATCGCCCATTTCATCGGTACTAACGGCGGCAGCGCCACGGGCTAAATCCCCGGTGCGAATGCCTTCTT

Rasmol

Open GNOME Terminal found under More Applications in the main menu and then type rasmol. This will launch Rasmol. Load a PDB file using File ‣ Open. This will prompt for a PDB file name in GNOME Terminal from where RasMol was launced. You can try loading the PDB file below as an example

/usr/share/python-biopython/Tests/PDB/1A8O.pdb

ClustalX

Open GNOME Terminal and type clustalx2. Use the Load sequences to load sequences from file. You can

• download a multi-fasta format file or
• copy the example file /usr/share/doc/packages/python-biopython/Doc/examples/opuntia.fasta from the BioPython package to /home/vlinux

Do an alignment using Alignment ‣ Do Complete Alignment